mcpbeat Sign in

Bio Workflows Clip Pipeline Agent Skill

End-to-end CLIP-seq pipeline from FASTQ to ENCODE-compliant binding sites, single-nucleotide crosslink maps, annotation, motifs, and (optionally) differential binding. Use when running the full Yeo lab eCLIP / iCLIP / iCLIP2 / iCLIP3 / irCLIP / PAR-CLIP analysis with SMInput control, protocol-specific UMI extraction, ENCODE STAR parameters, CLIPper or Skipper peak calling with stringent log2 FC and -log10 p thresholds, IDR rescue and self-consistency QC, and downstream motif registration with mCross or PEKA.

8k tokens
context cost
the whole folder, loaded on every use
3
files
ships runnable scripts
0
copies elsewhere
how many repositories repackaged it
132
stars on the repo
on the repository, not the skill itself

Install

one command, takes just this skill from the repository
npx skills add https://github.com/BioTender-max/awesome-bio-agent-skills --skill bio-workflows-clip-pipeline

What comes with it

14 538 bytes besides the instruction
examples/clip_full_pipeline.sh
usage-guide.md

The instruction itself

17 sections, as written by the author

Version Compatibility

Reference examples tested with: umi_tools 1.1.5+, cutadapt 4.6+, fastp 0.23+, STAR 2.7.11b+, samtools 1.19+, bedtools 2.31+, CLIPper 2.0+, Skipper (commit 2023.05+), PureCLIP 1.3.1+, HOMER 4.11+, ChIPseeker 1.40+, preseq 3.2+, picard 3.1+, idr 2.0.4+, MultiQC 1.21+.

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags
  • Python: pip show <package> then help(module.function) to check signatures
  • R: packageVersion('<pkg>') then ?function_name to verify parameters

If code throws unexpected errors, introspect the installed tool and adapt the example rather than retrying.

CLIP-seq End-to-End Pipeline

"Analyze my CLIP-seq data from raw FASTQ to ENCODE-compliant binding sites" -> Orchestrate protocol-specific UMI extraction, 3'-only adapter trimming (preserving the R2 5' truncation = crosslink site -1), ENCODE STAR alignment, UMI-based deduplication, library complexity QC, peak calling against SMInput with stringent thresholds (log2 FC >= 3 AND -log10 p >= 3), single-nucleotide crosslink-site detection, ChIPseeker annotation with CLIP-appropriate tssRegion, motif discovery with GC-matched background and CL-position registration, and optional differential binding between conditions.

Pipeline Overview

FASTQ + SMInput
  -> [clip-preprocessing]    UMI extract + 3' adapter trim (-q 6 -m 18) + two-pass for eCLIP
  -> [clip-alignment]        STAR ENCODE block (alignEndsType EndToEnd, mismatch 0.04 or 0.07 for PAR-CLIP) + UMI dedup
  -> [clip-qc]               preseq, FRiP, IDR rescue + self-consistency, read distribution
  -> [clip-peak-calling]     CLIPper + SMInput log2 norm (stringent: log2 FC >= 3, -log10 p >= 3) OR Skipper (210-320% more sites)
  -> [crosslink-site-detection] PureCLIP or CTK CITS for single-nt CL positions
  -> [binding-site-annotation] ChIPseeker (tssRegion=c(-100,100), level=transcript) + RBP-Maps for splicing factors
  -> [clip-motif-analysis]   HOMER + mCross (registered) + RBNS Kd cross-check
  -> [differential-clip]     DEWSeq window-level NB with type:condition interaction (optional)

CLIP Variant Selection

| Variant | When to use | UMI pattern | STAR mismatch ceiling | Detection signal |

|---------|-------------|-------------|----------------------|------------------|

| eCLIP (Van Nostrand 2016) | ENCODE comparability; SMInput available | 10 nt R1 | 0.04 | R2 5' truncation |

| iCLIP / iCLIP2 / iCLIP3 | Single-end; high motif specificity | NNNXXXXNN (3+4+2; demux first) | 0.04 | R1 5' truncation |

| irCLIP / FLASH | Non-radioactive; fast | Protocol-specific | 0.04 | Truncation |

| PAR-CLIP | Photoactivatable nucleoside (4SU); HEK293/K562 | 4 nt typical | 0.07 (raised for T->C) | T->C transitions |

| miCLIP / miCLIP2 | m6A modification | iCLIP-style | 0.04 | Truncation + C->T at m6A |

| STAMP / scSTAMP | Antibody-free; in vivo or single-cell | NA (no UV) | 0.04 (RNA-seq mode) | C->U editing (RBP-APOBEC1 fusion) |

| chimeric eCLIP / miR-eCLIP | Direct miRNA-target pairs | 10 nt R1 | 0.04 | Chimeric reads |

Step 1: Quality Control of Raw FASTQ

# Initial QC
fastqc raw_R1.fq.gz raw_R2.fq.gz -o qc/raw/

# Inspect first 12 bases of 100 reads to verify UMI pattern matches the prep
zcat raw_R1.fq.gz | awk 'NR%4==2' | head -100 | cut -c1-12 | sort | uniq -c | sort -rn | head
# Random barcode positions show ~25% per base; library barcodes are fixed

Step 2: Preprocessing (Protocol-Specific)

Goal: Convert raw CLIP FASTQ into UMI-deduplicated, alignment-ready FASTQ while preserving the R2 5' end (= crosslink site -1) that drives single-nucleotide resolution downstream.

Approach: Use the protocol-matched UMI pattern (10 nt eCLIP, NNNXXXXNN iCLIP, 4 nt PAR-CLIP), run umi_tools extract to move random barcodes to read names, then apply cutadapt with 3'-only adapter trimming at -q 6 -m 18 (permissive 5' to protect the truncation base). eCLIP uses two-pass trimming to remove read-through inline adapters from R2 5' only; iCLIP and PAR-CLIP use single-pass.

# eCLIP: 10 nt UMI on R1; two-pass adapter trim for read-through
# See clip-seq/clip-preprocessing for protocol-specific patterns
umi_tools extract \
    --bc-pattern=NNNNNNNNNN \
    --stdin=raw_R1.fq.gz --read2-in=raw_R2.fq.gz \
    --stdout=R1.umi.fq.gz --read2-out=R2.umi.fq.gz \
    --log=qc/umi_extract.log

# Pass 1: 3' adapter on both reads
# -q 6 is intentionally permissive; aggressive trimming destroys R2 5' = CL site -1
cutadapt \
    -a AGATCGGAAGAGCACACGTCT \
    -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    --quality-base 33 -q 6 -m 18 \
    -j 8 \
    -o R1.p1.fq.gz -p R2.p1.fq.gz \
    R1.umi.fq.gz R2.umi.fq.gz \
    > qc/cutadapt_pass1.log 2>&1

# Pass 2: strip read-through 5' adapter from R2 only (NEVER -g on R1)
cutadapt \
    -G GATCGTCGGACTGTAGAACTCTGAAC \
    --quality-base 33 -q 6 -m 18 \
    -j 8 \
    -o R1.trim.fq.gz -p R2.trim.fq.gz \
    R1.p1.fq.gz R2.p1.fq.gz \
    >> qc/cutadapt_pass2.log 2>&1

For PAR-CLIP: same UMI extraction but downstream alignment raises --outFilterMismatchNoverReadLmax from 0.04 to 0.07 (the T->C signature would otherwise be filtered as sequencing error). See clip-seq/clip-preprocessing for full per-protocol guidance.

Step 3: Alignment (ENCODE STAR Block)

# ENCODE eCLIP convention. Sacred: --alignEndsType EndToEnd (soft-clip would destroy truncation = CL site -1)
STAR --runMode alignReads \
    --runThreadN 16 \
    --genomeDir /path/to/STAR_hg38_index \
    --genomeLoad NoSharedMemory \
    --readFilesIn R1.trim.fq.gz R2.trim.fq.gz \
    --readFilesCommand zcat \
    --outFilterType BySJout \
    --outFilterMultimapNmax 1 \
    --alignEndsType EndToEnd \
    --outFilterMismatchNoverReadLmax 0.04 \
    --outFilterScoreMinOverLread 0.66 \
    --outFilterMatchNminOverLread 0.66 \
    --outSAMtype BAM SortedByCoordinate \
    --outSAMattributes All \
    --outFileNamePrefix sample_

samtools index sample_Aligned.sortedByCoord.out.bam

# MAPQ >= 10 (255 = unique in STAR; lower = multi-mapper)
samtools view -b -q 10 sample_Aligned.sortedByCoord.out.bam > sample_q10.bam
samtools index sample_q10.bam

# UMI dedup. ENCODE convention: --method=unique
umi_tools dedup \
    --stdin=sample_q10.bam \
    --stdout=sample_dedup.bam \
    --method=unique \
    --paired \
    --log=qc/dedup.log
samtools index sample_dedup.bam

For PAR-CLIP: change --outFilterMismatchNoverReadLmax 0.04 to 0.07. For repeat-binding RBPs (MATR3, ZFP36, FUS at LINE-1, HNRNPK at SINEs): change --outFilterMultimapNmax 1 to 100 and add --outSAMmultNmax -1, then run CLAM downstream for EM-based multi-mapper assignment. See clip-seq/clip-alignment for full guidance.

Step 4: QC (Five Gates)

# Gate 1: preprocessing retention (cutadapt log, target >= 70%)
grep -E "passing filters|Pairs written" qc/cutadapt_pass1.log

# Gate 2: alignment rate (STAR Log.final.out, target >= 60% eCLIP, 70% iCLIP)
grep "Uniquely mapped reads %" sample_Log.final.out

# Gate 3: library complexity (preseq, target >= 1M unique at sequenced depth)
preseq lc_extrap -B -P sample_q10.bam -o qc/preseq.txt

# Gate 4: FRiP (after peak calling; target >= 0.005 narrow-binding RBP)
# Gate 5: IDR replicate reproducibility (after peak calling; target rescue and self-consistency < 2)

# Aggregate all QC into a single MultiQC report
multiqc qc/ -o qc/multiqc/

CLIP libraries have 40-70% PCR duplication BY DESIGN (the IP enriches a small molecule pool). Low duplication usually means failed IP, not a good library. The unique-fragment count after UMI dedup is the actual quality metric. See clip-seq/clip-qc for full five-gate diagnostic.

Step 5: Peak Calling

# CLIPper (ENCODE canonical) + SMInput log2 normalization
clipper \
    -b sample_dedup.bam \
    -s hg38 \
    -o peaks/sample.clipper.bed \
    --FDR 0.05 \
    --superlocal \
    --save-pickle \
    --processors 8

# ENCODE stringent: log2(IP/SMInput) >= 3 AND -log10 p >= 3
# (Yeo lab eclip-pipeline scripts implement the normalization; see clip-seq/clip-peak-calling)
python overlap_peakfi_with_bam_PE.py \
    peaks/sample.clipper.bed \
    sample_dedup.bam sminput_dedup.bam \
    sample_dedup.bam.readnum.txt sminput_dedup.bam.readnum.txt \
    peaks/sample.normed.bed

python compress_l2foldenrpeakfi_for_replicate_overlapping_bedformat.py \
    peaks/sample.normed.bed \
    peaks/sample.compressed.bed

# Stringent filter
awk 'BEGIN{FS=OFS="\t"} $5 >= 3 && $6 >= 3' peaks/sample.compressed.bed > peaks/sample.stringent.bed

For maximum sensitivity (210-320% more sites than CLIPper for mRNA-binding RBPs), use Skipper Snakemake workflow with the same SMInput control. Mandatory for FASTKD2 / mt-RBPs which CLIPper misses on chrM. See clip-seq/clip-peak-calling for the full caller taxonomy.

# PureCLIP: HMM jointly modeling enrichment + truncation + CL motif
# Restrict to expressed transcripts to avoid HMM convergence issues
pureclip \
    -i sample_dedup.bam -bai sample_dedup.bam.bai \
    -g genome.fa \
    -ibam sminput_dedup.bam -ibai sminput_dedup.bam.bai \
    -o crosslinks/sample.sites.bed \
    -or crosslinks/sample.regions.bed \
    -nt 8 -dm 8 \
    -iv expressed_tx.bed

Single-nt CL sites feed mCross motif registration and allele-specific binding analyses. They are NOT a replacement for the broad peak list; complementary outputs. See clip-seq/crosslink-site-detection.

Step 7: IDR Across Replicates

# Sort each replicate's compressed BED by signal (log2 FC, column 5)
sort -k5,5gr peaks/rep1.compressed.bed > peaks/rep1.sorted.bed
sort -k5,5gr peaks/rep2.compressed.bed > peaks/rep2.sorted.bed

# True replicates threshold 0.05
idr --samples peaks/rep1.sorted.bed peaks/rep2.sorted.bed \
    --input-file-type bed --rank 5 \
    --output-file qc/idr.true.out \
    --idr-threshold 0.05 \
    --plot --log-output-file qc/idr.log

# ENCODE rule: rescue + self-consistency ratios both < 2 to pass
# Pseudo-replicate IDR (split BAM in half) at threshold 0.10

Step 8: Binding-Site Annotation

# CLIP-appropriate ChIPseeker (tssRegion tight; level=transcript)
library(ChIPseeker)
library(TxDb.Hsapiens.UCSC.hg38.knownGene)
txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene

peaks <- readPeakFile('peaks/sample.stringent.bed')
anno <- annotatePeak(
    peaks,
    TxDb = txdb,
    level = 'transcript',
    tssRegion = c(-100, 100),
    genomicAnnotationPriority = c('Promoter','5UTR','3UTR','Exon','Intron','Downstream','Intergenic')
)
plotAnnoPie(anno)

Default ChIPseeker tssRegion=c(-3000, 3000) over-extends for CLIP (would label 30-50% peaks as "Promoter"). Splicing factors additionally need RBP-Maps (Yeo lab) for the 1400 nt cassette-exon regulatory metagene. See clip-seq/binding-site-annotation.

Step 9: Motif Analysis (De Novo + CL-Registered)

# Extract peak sequences (strand-preserving)
bedtools getfasta -fi genome.fa -bed peaks/sample.stringent.bed -s -fo motifs/peaks.fa

# GC-matched 3' UTR background (NOT auto-shuffled, which biases to AU)
bedtools shuffle -i peaks/sample.stringent.bed -g chrom.sizes \
    -incl expressed_3utr.bed -seed 42 > motifs/background.bed
bedtools getfasta -fi genome.fa -bed motifs/background.bed -s -fo motifs/background.fa

# HOMER de novo
findMotifs.pl motifs/peaks.fa fasta motifs/homer \
    -rna -len 5,6,7,8 -p 8 -fasta motifs/background.fa

# mCross for CL-position-registered motif (requires single-nt CL sites)
mCross -i crosslinks/sample.sites.bed -g genome.fa -k 7 -n 5 -o motifs/mcross

UV254 crosslinking has a strong U bias (~60-80% CL events at U); naive logos centered on CL positions are U-enriched even for non-U-binding RBPs. mCross corrects this by registering motif relative to the CL offset. See clip-seq/clip-motif-analysis.

Step 10: Differential Binding (Optional, Across Conditions)

# DEWSeq window-level NB with the interaction-term design
# The interaction `~ type + condition + type:condition` tests whether IP/SMInput ratio shifts;
# naive `~ condition` confounds binding with expression changes.
library(DEWSeq)
counts <- read.table('counts/merged.tsv', sep='\t', header=TRUE, row.names=1)
colData <- data.frame(
    type = c('ip','ip','ip','ip','sminput','sminput','sminput','sminput'),
    condition = c('treat','treat','ctrl','ctrl','treat','treat','ctrl','ctrl')
)
dds <- DESeqDataSetFromSlidingWindows(
    countData=counts, colData=colData,
    annotObj='annotation_windows.bed',
    design = ~ type + condition + type:condition
)
dds <- DESeq(dds)
res <- results(dds, name='typeip.conditiontreat')

See clip-seq/differential-clip for full DEWSeq workflow and the htseq-clip preprocessing required upstream.

Quality Checkpoints

| Step | Metric | ENCODE target |

|------|--------|---------------|

| Preprocessing | Retention after adapter trim | >= 70% |

| Alignment | Unique mapping rate | >= 60% (eCLIP); >= 70% (iCLIP) |

| Complexity | preseq predicted unique at 100M reads | >= 10M (good); >= 1M (minimum acceptable) |

| Peak calling | FRiP (narrow-binding RBP) | >= 0.005 |

| Peak calling | Stringent peaks log2(IP/SMI) | >= 3 |

| Peak calling | Stringent peaks -log10 p | >= 3 |

| IDR | Rescue ratio | < 2 |

| IDR | Self-consistency ratio | < 2 |

| Annotation | Top RBP-class match expectation | Y (HuR -> 3' UTR; PTBP1 -> intron; FASTKD2 -> chrM) |

Per-Variant Adjustments

  • PAR-CLIP: Raise STAR --outFilterMismatchNoverReadLmax from 0.04 to 0.07; downstream use PARalyzer or CTK CIMS substitution T->C
  • iCLIP / iCLIP2 multiplexed: Demultiplex by inline library barcode (NNNXXXXNN) BEFORE umi_tools extract
  • HITS-CLIP: Use deletion-tolerant aligner (BWA-aln); downstream CTK CIMS deletion mode
  • Repeat-binding RBPs: STAR --outFilterMultimapNmax 100 --outSAMmultNmax -1 + CLAM EM rescue
  • m6A profiling: Switch to clip-seq/m6a-clip (miCLIP2 + m6Aboost or GLORI)
  • Antibody unavailable: Switch to clip-seq/stamp-antibody-free (STAMP or TRIBE)
  • miRNA targets: Switch to clip-seq/ago-clip-mirna-targets (chimeric eCLIP / miR-eCLIP)
  • Variant-effect prediction: Use clip-seq/clip-deep-learning (RBPNet or RNAProt)
  • clip-seq/clip-preprocessing - UMI extraction and adapter trimming details
  • clip-seq/clip-alignment - STAR ENCODE block + multi-mapper rescue
  • clip-seq/clip-qc - Five-gate QC framework
  • clip-seq/clip-peak-calling - CLIPper / Skipper / PureCLIP / CTK taxonomy
  • clip-seq/crosslink-site-detection - Single-nt CL detection by chemistry
  • clip-seq/binding-site-annotation - ChIPseeker + RBP-Maps
  • clip-seq/clip-motif-analysis - HOMER + mCross + RBNS validation
  • clip-seq/differential-clip - DEWSeq + Flipper for cross-condition
  • clip-seq/m6a-clip - miCLIP2 / GLORI / DART for m6A modifications
  • clip-seq/stamp-antibody-free - STAMP / TRIBE for antibody-free profiling
  • clip-seq/ago-clip-mirna-targets - chimeric eCLIP for direct miRNA-target pairs
  • clip-seq/clip-deep-learning - RBPNet / RNAProt for variant-effect prediction
  • read-qc/quality-reports - FastQC / MultiQC upstream QC
  • alternative-splicing/differential-splicing - Cassette exon tables for RBP-Maps

Other skills for the same job

different authors, same section of the catalogue
Azure Kubernetes Automatic Readiness
by microsoft
vendor ×3

Assess Kubernetes workloads and cluster configuration for AKS Automatic compatibility. Identifies incompatibilities, generates fixes, and guides migration from AKS Standard to AKS Automatic. WHEN: migrate to AKS Automatic, check AKS Automatic readiness, validate manifests for Automatic, assess cluster for Automatic compatibility, fix deployment for Automatic compatibility, identify AKS Automatic migration blockers, is my cluster ready for AKS Automatic.

13k tokens
Capacity
by microsoft
vendor ×3

Discovers available Azure OpenAI model capacity across regions and projects. Analyzes quota limits, compares availability, and recommends optimal deployment locations based on capacity requirements. USE FOR: find capacity, check quota, where can I deploy, capacity discovery, best region for capacity, multi-project capacity search, quota analysis, model availability, region comparison, check TPM availability. DO NOT USE FOR: actual deployment (hand off to preset or customize after discovery), quota increase requests (direct user to Azure Portal), listing existing deployments.

6k tokens scripts
Customize
by microsoft
vendor ×3

Interactive guided deployment flow for Azure OpenAI models with full customization control. Step-by-step selection of model version, SKU (GlobalStandard/Standard/ProvisionedManaged), capacity, RAI policy (content filter), and advanced options (dynamic quota, priority processing, spillover). USE FOR: custom deployment, customize model deployment, choose version, select SKU, set capacity, configure content filter, RAI policy, deployment options, detailed deployment, advanced deployment, PTU deployment, provisioned throughput. DO NOT USE FOR: quick deployment to optimal region (use preset).

8k tokens
Deploy Model
by microsoft
vendor ×3

Unified Azure OpenAI model deployment skill with intelligent intent-based routing. Handles quick preset deployments, fully customized deployments (version/SKU/capacity/RAI policy), and capacity discovery across regions and projects. USE FOR: deploy model, deploy gpt, create deployment, model deployment, deploy openai model, set up model, provision model, find capacity, check model availability, where can I deploy, best region for model, capacity analysis. DO NOT USE FOR: listing existing deployments (use foundry_models_deployments_list MCP tool), deleting deployments, agent creation (use agent/create), project creation (use project/create).

26k tokens scripts
Preset
by microsoft
vendor ×3

Intelligently deploys Azure OpenAI models to optimal regions by analyzing capacity across all available regions. Automatically checks current region first and shows alternatives if needed. USE FOR: quick deployment, optimal region, best region, automatic region selection, fast setup, multi-region capacity check, high availability deployment, deploy to best location. DO NOT USE FOR: custom SKU selection (use customize), specific version selection (use customize), custom capacity configuration (use customize), PTU deployments (use customize).

9k tokens
Lamindb
by christophacham
×3

This skill should be used when working with LaminDB, an open-source data framework for biology that makes data queryable, traceable, reproducible, and FAIR. Use when managing biological datasets (scRNA-seq, spatial, flow cytometry, etc.), tracking computational workflows, curating and validating data with biological ontologies, building data lakehouses, or ensuring data lineage and reproducibility in biological research. Covers data management, annotation, ontologies (genes, cell types, diseases, tissues), schema validation, integrations with workflow managers (Nextflow, Snakemake) and MLOps platforms (W&B, MLflow), and deployment strategies.

22k tokens
Latchbio Integration
by christophacham
×3

Latch platform for bioinformatics workflows. Build pipelines with Latch SDK, @workflow/@task decorators, deploy serverless workflows, LatchFile/LatchDir, Nextflow/Snakemake integration.

12k tokens
Modal
by christophacham
×3

Run Python code in the cloud with serverless containers, GPUs, and autoscaling. Use when deploying ML models, running batch processing jobs, scheduling compute-intensive tasks, or serving APIs that require GPU acceleration or dynamic scaling.

17k tokens

How to use it

Copy the folder

Take biotender-max/bio-workflows-clip-pipeline from the repository into ~/.claude/skills for personal use, or into .claude/skills inside a project.

Check the name does not clash

The agent identifies a skill by the name field in its header. Two skills with the same name cannot sit side by side — one of them will be ignored.